JRF NET Life Sciences June 2018 Model Question Paper

In a normal cell, the phosphatidylserine residues are located at the:

What is the average resting potential of a mammalian neuron?

The concentration of which of the following ion is responsible for the resting potential of the plasma membrane?

The most important cation source in the cell lumen is:

Glucose transporter in the membrane is an example for:

Oxygen and carbon dioxide pass through the plasma membrane by:

Major regulatory step in the cholesterol biosynthesis pathway is:

The possible combination of gametes which can be formed by the genotype AaBbCcDdEeFfGg are:

Which of the following statement is correct regarding meiotic cell division?

Which of the following monochromatic lights are more suitable for plant growth?

Consider the following DNA sequence 5’ATGGGCATAGACGATATGGTAG3’. If due to frame-shift mutation there is insertion of G between 3rd and 4th position. Consider a reverse mutation occur in same mutated sequence. Which reverse mutation will have minimum effect in protein change?

A tryptophan auxotroph in corn showed 50 times more accumulation of IAA than the normal. Probable explanation for this is:

The pitcher plant Nepenthes would be expected to have:

With time the molecular distance between organisms increases during evolution due to:

Major cause of evolution of genes and proteins is: