GATE BT (Biotechnology) Online Mock Test 02

Which of the following is not a co‐dominant marker?

Two species A and B were hybridized to form species C. Which of the following techniques can be used to confirm that the resultant species C is a hybrid?

A molecular marker cannot be utilized for:

Among the following which would be the most suitable marker for the selection of animals with agronomic traits:

Interspecific hybrids have proved very useful for:

Alu elements are:

During transposition, transposons are excised by:

The type of mutation which is most suitable for studying the regulation of DNA replication is:

A test to determine whether two mutant sites of a gene are in the same functional unit or gene:

Consider the following DNA sequence 5’ATGGGCATAGACGATATGGTAG3’. If due to frame-shift mutation there is an insertion of G between 3rd and 4th position. Consider a reverse mutation occur in the same mutated sequence. Which reverse mutation will have minimum effect in protein change?

Which of the following is a Triplet Repeat disorder?

A mutation changes the codon in such a way that there is no effect on functioning and overall structure of the protein. This type of mutation is termed as:

Albinos have a visual problem in bright light because they lack:

Ames test is performed to detect:

Maximum possible isomers for glucose are